For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 011029
Protocol 41115: Probe Assay - Rpl22<tm1.1Psam> Probe Alternate2
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 70 bp
Wild Type = 72 bp
chr4:152332058+152332129 72bp GTCTTTCTCTAGTGGTCTCTCCAG GCTTGGCAATAAAAGTGAGACC
Sequence
Wt Sequence: gaggtggaaggtgtgtggagccgtcggctcacctgtgcggtctttctctagtggtctctccagaccattctctaGACgtctgctgatatggtctcacttttattgccaagctagggatgtgtgatagacgc
Mutant Sequence: AGACGAGAGGCTGGGTGGTGGGCTCCGGCCAGCCCGAGTCTTAGAGCTGGTGGTTGGTTATATCTGGTGCCTGTCTCGAGGccgctctagtcgacccgtaccttgtcgagtccgataacttcgtataatgtatgctatacgaagttatggcgcgaattcaacgaagttcctatactttctagagaataggaacttcggaataggaacttcgttggatctcgagtttaaacttaagtatcgCTGCTGATATGGTCTCACT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44837 | GTC TTT CTC TAG TGG TCT CTC CAG | Wild type Forward | A | |||
| 44838 | GCT TGG CAA TAA AAG TGA GAC C | Wild type Reverse | A | |||
| 44840 | Fluorophore-1 | CCA TTC TCT AGA CGT CTG CTG A | Quencher-1 | WT Probe | ||
| 57060 | GCT GGT GGT TGG TTA TAT CTG G | Mutant Forward | A | |||
| 57061 | TCG GAC TCG ACA AGG TAC G | Mutant Reverse | A | |||
| 57062 | Fluorophore-2 | CTC GAG GCC GCT CTA GTC GAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44837 | 0.40 uM |
| 44838 | 0.40 uM |
| 57060 | 0.40 uM |
| 57061 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.