Stock No: 010810
Protocol 3630: Pyrosequencing Assay - mt Atp8<m1>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

GGTTCCACTAAAATATTTCGAAAACTGATCTGCTTCAATAATTTAATTTCACTATGAA
GCTAAGAGCGTTAACCTTTTAAGTTAAAGTTAGAGACCTTAAAATCTCCATAGTGAT
ATGCCACAACTA(g/t)ATctATCAACATGATTTATCACAATTATCTCATCAATAATTACCCT
ATTTATCTTATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACC
AAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAAT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
9228 ATC TCC ATA GTG ATA TGC CAC AAC
9229 Fluorophore GTG GGA ATG TTT GTG ATG AGA CTT
9230 AGT GAT ATG CCA CAA CT

Reaction A

Component Final Concentration
ddH2O
KAPA LR HotStart Buf Buffer does not contain MgCl2. 1.00
MgCl2 2.00
dNTP 0.13
KAPA LR HotStart Taq Initial Denature 3 Min This is a two enzyme system. One with proofreeading the other without. HotStart is provided by antibody. 0.02
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 60.0 --
4 65.0 --
5 -- Go to step 2-4, 50 times
6 65.0 --
7 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
010810 C57BL/6J-mtFVB/NJ/IbraJ
010809 NOD/ShiLtJ-mtFVB/NJ/IbraJ
2 strains use this protocol