Protocol 41166: Separated PCR Assay - Tg(CAG-luc,-GFP)L2G85Chco-Chr7-alt1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 289 bp
Heterozygote = 231 bp and 289 bp
Wild type = 231 bp

>chr7:4564358-4564588 231bp AGTGGGCTCTTCTACCCACA GGATCCATCCATCAAAGGTG

This assay is capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 7.

This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
43224 GGC GTT ACT ATG GGA ACA TAC G Mutant Forward B CMV enhancer
57313 AGT GGG CTC TTC TAC CCA CA Wild type Forward A mChr7
57314 GGA TCC ATC CAT CAA AGG TG Common A, B mChr7

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
57313 0.50 uM
57314 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
43224 0.50 uM
57314 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
025854 B6;FVB-Ptprca Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J
010545 C.FVB-Tg(CAG-luc,-GFP)L2G85Chco/FathJ
010548 D1.FVB(Cg)-Tg(CAG-luc,-GFP)L2G85Chco/FathJ
008450 FVB-Tg(CAG-luc,-GFP)L2G85Chco/J
010542 NOD.FVB-Tg(CAG-luc,-GFP)L2G85Chco/FathJ
025855 STOCK Ptprca Lag3tm1Doi Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J
6 strains use this protocol