For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 009659
Protocol 30074: End Point Analysis Assay - Dock7<m>-Probe
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = retrotransposon LTR insertion
Sequence
Wild Type Dock7
acataatgatttcaataacagacacgtgtcttttttatttaaagTGGATACCAATGCTGCAG
AATGGACGGTTGAAGACAGGGCAGTTCTGCCTGCCAGTCTCCCTGGAAAAACCACCGCAGGC
TTATTCAGTGCTTTCCCCCGAGgtcagtgccttccagcaag
Dock7<m>
ACATAATGATTTCAATAACAGACACGTGTCTTTTTTATTTAAAGTGGATACCAATGCTGCAG
AATGGACGGTTGAAGACCAGTTGCAGAAACGAGGATTATAAAGTAATATGAATGCCCATTGT
AAATTTACTAATGCGTTTGCGATTGTACGAGGGATAGTTAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 14825 | AGT GGA TAC CAA TGC TGC AG | Common | A | |||
| 14826 | TGG TTT TTC CAG GGA GAC TG | Wild type Reverse | A | |||
| 14828 | GGG CAT TCA TAT TAC TTT ATA ATC CTC G | Mutant Reverse | A | |||
| 33838 | Fluorophore-1 | TCT GCA ACT GGT CTT CAA CCG TCC | Quencher-1 | MUT Probe | ||
| 33839 | Fluorophore-2 | ATG GAC GGT TGA AGA CAG GGC A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 14825 | 0.40 uM |
| 14826 | 0.40 uM |
| 14828 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.