For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 009361
Protocol 21926: End Point Analysis Assay - Btk<xid>End Point
Version 4.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T
Heterozygote = T/C
Wild type = C
X-Linked
Sequence
The C to T transition point mutation at position 219 is predicted to change amino acid 28 from an arginine to a cysteine in the encoded protein. (J:13209)
GCTGCAGTGATACTGGAGAGCATCTTTCTGAAGCGCTCCCAGCAGAAAAAGAAAA
CATCACCTTTAAACTTCAAGAAG(c/t)GCCTGTTTCTCTTGACTGTACACAAACTTTCA
TACTATGAATATGACTTTGAACGTGGGGTAAGTTTCCCAAATGAG
GCTGCAGTGATACTGGAGAGCATCTTTCTGAAGCGCTCCCAGCAGAAAAAGAAAA
CATCACCTTTAAACTTCAAGAAG(c/t)GCCTGTTTCTCTTGACTGTACACAAACTTTCA
TACTATGAATATGACTTTGAACGTGGGGTAAGTTTCCCAAATGAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 16120 | TGG AGA GCA TCT TTC TGA AGC | Forward | A | |||
| 16121 | GAA ACT TAC CCC ACG TTC AAA G | Reverse | A | |||
| 16122 | Fluorophore-1 | CTT CAA GAA GTG CCT GTT TCT | Quencher-1 | MUT Probe | ||
| 16411 | Fluorophore-2 | CTT CAA GAA GCG CCT GTT TCT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 16120 | 0.40 uM |
| 16121 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.