Stock No: 009157
Protocol 21918: End Point Analysis Assay - Ank1<pale>-EP
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = A/A
Heterozygote = G/A
Wild type = G/G

 

 

Sequence

aatatctaataaaataaaattttaaaaaattaaaactgaaagagagagacaggaggccctttctcttctgca[g/a]GCATCTAAAGA

ATATGATGAGGATTCCCTCATTCCCAGCAGCCCGGCCACAGAGACCTCAGACAACATTAGCCCTGTGGCTA

GCCCGGT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
17262 TAG GGG ACT TTC GGG ATA GC Forward A
17263 AGC CAC AGG GCT AAT GTT GT Reverse A
17267 Fluorophore-1 TCT CTT CTG CAG GCA TCT AAA GA Quencher-1 WT Probe
17268 Fluorophore-2 TTC TCT TCT GCA AGC ATC TAA AGA A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
17262 0.40 uM
17263 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.