Stock No: 009067
Protocol 35496: Probe Assay - Postn<tm1Jmol> Probe
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:54367443+54367570 128bp GTGAAGGAACATTCTGGAAATC TCGGAGTAGTGCTGAGTGGT

 

Mutant=  116 bp

Wild Type = 128 bp

Fam=Mut

Hex=Wt

Sequence

WT Sequence:  gtgaaggaacattctggaaatcaacttctaagcatttgttcgattctgactCTttcagtgatgcctattgaccatgtttatggcacgctgggcattgtgggagccactaccactcagcactactccga

 

MUT Sequence: GTGAAGGAACATTCTGGAAATCAACTTCTAAGCATTTGTTCGATTCTGACTCaagctttctagggtacctctagctcgaggggcgcgcccccagctggttctttccgcctcagaag

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
12153 CTT CTG AGG CGG AAA GAA CC Mutant Reverse A
46218 GTG AAG GAA CAT TCT GGA AAT C Common A
46219 TCG GAG TAG TGC TGA GTG GT Wild type Reverse A
46220 Fluorophore-1 CAA GCT TTC TAG GGT ACC TCT AGC TC Quencher-1 MUT Probe
46222 Fluorophore-2 CAG TGA TGC CTA TTG ACC ATG T Quencher-2 WT Probe

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
12153 0.50 uM
46218 0.50 uM
46219 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.