Genotyping Protocols Database
Protocol 18025: End Point Analysis Assay - Psen1<tm1Mpm>-EP
Version 4.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant GTC GTG GTG ACC

Wild type GTC ATT ATG ACC

 

Sequence

AAAAGACTCATTAAACCGCAGACCTCACAGTGAATTACAGTTTTAAGAGTGTGCTGTTTG
ACATATGCATTAACACTCTGGTGTTTTGTTTCCCTCTGTAGAATCTACACCCCATTCACAGA
AGACACTGAGACTGTAGGCCAAAGAGCCCTGCACTCGATCCTGAATGCGGCCATCATGAT
CAGTGTCATTGTC(a/g) T (t/g) (a/g) TGACCATCCTCCTGGTGGTCCTGTATAAATACAGGTG
CTACAAGGTGAGCACGAGGCAGTCTGCTGTCCGCCTTGACCTGCCTATGGGTTGTCCTT
GTGTGTGTGGGAGGGGAAGGGTGGGAGAGTTGGGGGCGGGGGAGATGTGTATGCAGG
CCTGTGCATGTCAGAGTGTGCGTGTGCAGTTGGTAGGACCACTTTGTGGAATG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
17090 CAC CCC ATT CAC AGA AGA CA Forward A
17091 CAA CCC ATA GGC AGG TCA AG Reverse A
17092 Fluorophore-1 TGT CAT TGT CAT TAT GAC CAT CCT Quencher-1 Wild type A
17093 Fluorophore-2 TCA TTG TCG TGG TGA CCA TC Quencher-2 Mutant A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
17090 0.40 uM
17091 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
004193 B6.129-Psen1tm1Mpm/J
004807 B6;129-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/Mmjax
008880 B6.Cg-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/J
031988 129S4.Cg-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/LfaJ
4 strains use this protocol