Genotyping Protocols Database
Protocol 14825: Pyrosequencing Assay - Psen1<tm1Mpm>
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

 

AAAAGACTCATTAAACCGCAGACCTCACAGTGAATTACAGTTTTAAGAGTGTGCTGTTTG
ACATATGCATTAACACTCTGGTGTTTTGTTTCCCTCTGTAGAATCTACACCCCATTCACAGA
AGACACTGAGACTGTAGGCCAAAGAGCCCTGCACTCGATCCTGAATGCGGCCATCATGAT
CAGTGTCATTGTC(a/g) T (t/g) (a/g) TGACCATCCTCCTGGTGGTCCTGTATAAATACAGGTG
CTACAAGGTGAGCACGAGGCAGTCTGCTGTCCGCCTTGACCTGCCTATGGGTTGTCCTT
GTGTGTGTGGGAGGGGAAGGGTGGGAGAGTTGGGGGCGGGGGAGATGTGTATGCAGG
CCTGTGCATGTCAGAGTGTGCGTGTGCAGTTGGTAGGACCACTTTGTGGAATG

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
12730 Fluorophore CAA AGA GCC CTG CAC TCG AT
12731 AGA CTG CCT CGT GCT CAC CTT
12732 CCA GGA GGA TGG TCA

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.00
MgCl2 2.00
dNTPS-kapa 0.20
12730 0.50
12731 0.50
Glycerol 5.00
Kapa 2G HS taq polym 0.01
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
004193 B6.129-Psen1tm1Mpm/J
008880 B6.Cg-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/J
004807 B6;129-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/Mmjax
3 strains use this protocol