Protocol 37947: Probe Assay - Tg(CAG-cre)- Probe
Version 1.0

Notes

This assay cannot distinguish hemi from hom

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Tg=  124 bp

IPC = 74 bp

Sequence

Tg Sequence:

TGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTCGGGCCCCCCCTCGAGGGGCAGAGCCGATCCTGTACACTTTACTTAAAACCATTATCTGAGTGTGAAATGTTCAATTTACTGACCGTACACCAAAATTTGCCTAG

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
34918 TGT GCT GTC TCA TCA TTT TGG Transgene Forward A
52581 TTG GTG TAC GGT CAG TAA ATT G Transgene Reverse A
52582 Fluorophore-1 AGG GGC AGA GCC GAT CCT Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
34918 0.40 uM
52581 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
007966 B6.Cg-Smn1tm3(SMN2/Smn1)Mrph/J
004682 B6.Cg-Tg(CAG-cre/Esr1*)5Amc/J
019102 B6N.Cg-Tg(CAG-cre/Esr1*)5Amc/CjDswJ
017595 FVB.Cg-Tg(CAG-cre/Esr1*)5Amc/J
034859 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CAG-cre/Esr1*)5Amc/J
034795 NOD.Cg-Tg(CAG-cre/Esr1*)5Amc/J
008783 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J
008813 STOCK Trpa1tm2Kykw Tg(CAG-cre/Esr1*)5Amc/J
004453 STOCK Tg(CAG-cre/Esr1*)5Amc/J
9 strains use this protocol