Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 105 bp
Wild Type = 132 bp
>chr11:69398179+69398310 132bp CAGCCTGCCTAGCTTCCTC AGAAAATGTTGGCTGGGAAAG
Wt Sequence: tcaatagcagcctgcctagcttcctcaggatcaaatgagatgagcccctgagaagagcaaggcccgctgggcctggaaggccagccctggttgtactcaaacCTCTCGAgtctattgcctttcccagccaacattttcttacacatccagcctctgtggatactgtgaccctcctgatctggttcttgtgaaaagtttcatattggcaact
Mutant Sequence: agctagccaccatGGCTTGAGTAAGTCTGCAGGTCGAGGGACCTAATAACTTCGTATAGCATACATTATACGAAGTTATgtcGAGTCTATTGCCTTTCCCAGCCAACATTTTCTTACACATCCAGCC
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
25929 | CCA TGG CTT GAG TAA GTC TGC A | Mutant Forward | A | |||
35283 | AGA AAA TGT TGG CTG GGA AAG | Common | A | |||
35284 | CAG CCT GCC TAG CTT CCT C | Wild type Forward | A | |||
35285 | Fluorophore-1 | TCG AGG GAC CTA ATA ACT TCG TAT AGC A | Quencher-1 | MUT Probe | ||
35286 | Fluorophore-2 | CCT GGT TGT ACT CAA ACC TCT CGA GTC | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
25929 | 0.40 uM |
35283 | 0.40 uM |
35284 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |