Stock No: 008652
Protocol 30721: Probe Assay - Trp53<tm2Tyj> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  105 bp

Wild Type = 132 bp

>chr11:69398179+69398310 132bp CAGCCTGCCTAGCTTCCTC AGAAAATGTTGGCTGGGAAAG

Sequence

Wt Sequence: tcaatagcagcctgcctagcttcctcaggatcaaatgagatgagcccctgagaagagcaaggcccgctgggcctggaaggccagccctggttgtactcaaacCTCTCGAgtctattgcctttcccagccaacattttcttacacatccagcctctgtggatactgtgaccctcctgatctggttcttgtgaaaagtttcatattggcaact

 

Mutant Sequence: agctagccaccatGGCTTGAGTAAGTCTGCAGGTCGAGGGACCTAATAACTTCGTATAGCATACATTATACGAAGTTATgtcGAGTCTATTGCCTTTCCCAGCCAACATTTTCTTACACATCCAGCC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
25929 CCA TGG CTT GAG TAA GTC TGC A Mutant Forward A
35283 AGA AAA TGT TGG CTG GGA AAG Common A
35284 CAG CCT GCC TAG CTT CCT C Wild type Forward A
35285 Fluorophore-1 TCG AGG GAC CTA ATA ACT TCG TAT AGC A Quencher-1 MUT Probe
35286 Fluorophore-2 CCT GGT TGT ACT CAA ACC TCT CGA GTC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
25929 0.40 uM
35283 0.40 uM
35284 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.