Protocol 33818: Probe Assay - Generic iCre Probe
Version 5.0

Notes

This assay will NOT distinguish hemizygous from homozygous

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Transgene = 89 bp
Internal positive control = 74 bp

 

Sequence

Tg Sequence:

 

 

 ATGCTCCTGTCTGTGTGCAGATCCTGGGCTGCCTGGTGCAAGCTGAACAACAGGAAATGGTTCCCTGCTGAACCTGAGGATGTGAGGGA

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
22926 TCC CTC ACA TCC TCA GGT TC Internal Positive Control Reverse A
41665 ATG CTC CTG TCT GTG TGC AG Transgene Forward A
41666 Fluorophore-1 TGC CTG GTG CAA GCT GA Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
22926 0.40 uM
41665 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
009587 B6(129S4)-Et(icre)1402Rdav/J
009588 B6(129S4)-Et(icre)1470Rdav/J
009589 B6(129S4)-Et(icre)1555Rdav/J
009586 B6(129S4)-Et(icre)754Rdav/J
010696 B6(129S4)-Et(icre/ERT2)10596Rdav/J
010697 B6(129S4)-Et(icre/ERT2)10727Rdav/J
012689 B6(129S4)-Et(icre/ERT2)14163Rdav/J
012690 B6(129S4)-Et(icre/ERT2)14208Rdav/J
012694 B6(129S4)-Et(icre/ERT2)14915Rdav/J
012687 B6(129S4)-Tg(SYN1-icre/mRFP1)9934Rdav/J
008610 B6.Cg-Commd10Tg(Vav1-icre)A2Kio/J
023677 B6.Cg-Hprttm332(Ple272-icre/ERT2)Ems/Mmjax
023690 B6.Cg-Hprttm345a(icre/ERT2)Ems/Mmjax
023691 B6.Cg-Hprttm346a(Ple264-icre/ERT2)Ems/Mmjax
023692 B6.Cg-Hprttm347a(Ple155-icre/ERT2)Ems/Mmjax
023693 B6.Cg-Hprttm348a(Ple265-icre/ERT2)Ems/Mmjax
023694 B6.Cg-Hprttm349a(hs671-icre/ERT2)Ems/Mmjax
023695 B6.Cg-Hprttm350a(Ple232-icre/ERT2)Ems/Mmjax
023696 B6.Cg-Hprttm351a(Ple198-icre/ERT2)Ems/Mmjax
023697 B6.Cg-Hprttm352a(Hspa1a-icre/ERT2)Ems/Mmjax
023698 B6.Cg-Hprttm353(Ple274-icre/ERT2)Ems/Mmjax
023699 B6.Cg-Hprttm354(Ple283-icre/ERT2)Ems/Mmjax
023705 B6.Cg-Hprttm360a(Ple253-icre/ERT2)Ems/Mmjax
023706 B6.Cg-Hprttm361a(Ple267-icre/ERT2)Ems/Mmjax
023708 B6.Cg-Hprttm363a(hs1218-icre/ERT2)Ems/Mmjax
023709 B6.Cg-Hprttm364a(CAG-icre/ERT2)Ems/Mmjax
023710 B6.Cg-Hprttm365a(Ple266-icre/ERT2)Ems/Mmjax
023711 B6.Cg-Hprttm366a(Ple67-icre/ERT2)Ems/Mmjax
023712 B6.Cg-Hprttm367a(Ple251-icre/ERT2)Ems/Mmjax
017490 B6.FVB-Tg(Stra8-icre)1Reb/LguJ
029231 B6;129-Bhlha15tm4Skz/J
030663 B6;129S-Gcgtm1.1(icre)Gkg/J
026555 B6;CBA-Tg(Lhx6-icre)1Kess/J
018968 B6N.Cg-Commd10Tg(Vav1-icre)A2Kio/J
030676 C57BL/6N-Tg(Tg-cre/ERT2)1Kero/J
021024 FVB-Tg(Csf1r-icre)1Jwp/J
008694 NOD/ShiLt-Tg(Foxp3-EGFP/cre)1cJbs/J
012691 STOCK Et(icre/ERT2)14374Rdav/J
012692 STOCK Et(icre/ERT2)14602Rdav/J
012693 STOCK Et(icre/ERT2)14624Rdav/J
027798 STOCK Tg(Nkx6-2-icre)1Kess/SshiJ
018147 STOCK Tg(Slc17a8-icre)1Edw/SealJ
008208 STOCK Tg(Stra8-icre)1Reb/J
43 strains use this protocol