Stock No: 008577
Protocol 37276: Standard PCR Assay - Gpr65<tm1Witt> Alternate2
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 227 bp
Heterozygote = 227 bp and 339 bp
Wild type = 339 bp

chr12:98276098+98276436 339bp GACTAAGAGGTGGAGGCAGGT GACTGATGCAGGCAGACTGA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50967 TGG ACC ATC CAG AGA CTG C Mutant Reverse A Mut R
50968 GAC TAA GAG GTG GAG GCA GGT Wild type Forward A Wt F
50969 GAC TGA TGC AGG CAG ACT GA Wild type Reverse A Wt R
oIMR8444 GCC TGA AGA ACG AGA TCA GC Mutant Forward A Mut F

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
50967 0.50 uM
50968 0.50 uM
50969 0.50 uM
oIMR8444 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.