For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 008576
Protocol 37295: Standard PCR Assay - Gpr132<tm1Witt> Alternate3
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ~250 bp
Heterozygote = ~250 bp and 333 bp
Wild type = 333 bp
>chr12:112852719-112853051 333bp CTGGGCCTACCAGCCAAC ACACGCAGAAATGGTGACAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50272 | AGT CTG AGG TGC GAG AAA CC | Mutant Reverse | A | Mut R | ||
| 50989 | CTG GGC CTA CCA GCC AAC | Wild type Forward | A | Wt F | ||
| 50990 | ACA CGC AGA AAT GGT GAC AG | Wild type Reverse | A | Wt R | ||
| oIMR2088 | AGA CTG CCT TGG GAA AAG CG | Mutant Forward | A | Mut F |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 50272 | 0.50 uM |
| 50989 | 0.50 uM |
| 50990 | 0.50 uM |
| oIMR2088 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.