Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 92 bp
Wild Type = 125 bp
Wt Sequence: gctcatacacgggtgtgctcacggctgcagtgataagtggcttagtcccagaagtacaaatggtgaggagtggtggaggacatggcccctggtacctgCagaggctctatgggaaggctgacaggtggatcCCgggggcgggggtggag
gggtgctggactcagaggcaggcagctggaatcttcctggggccagcctggaagggtaagagaggacccagatatagggctttaggcacctcccgaaggcgatgtttgcttctctcttcctctttagtctaccttggtgctccctttaagtgatggaag
gaactgtctcttccggctgg
Mutant Sequence: GGTTCAGTGGCCTGACCCCCTGGATCACGGGTGTGCTCATACACGGGTGTGCTCACGGCTGCAGTGATAAGTGGCTTAGTCCCAGAAGTACAAATGGTGAGGAGTGGTGAAGG
ACATGGCCCCTGGTACCTGCAGAGGCTCTATGGGAAGGCTGACAGGTGGATCCatcgattctagagatatcctcgagggcccctgcaggtcaattctaccgggtaggggaggcgcttttcccaaggcagtctggag
catgcgctttagcagccccgctgggcact
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33082 | TCT ATG GGA AGG CTG ACA GG | Common | A | |||
33083 | AGC CCT ATA TCT GGG TCC TCT | Wild type Reverse | A | |||
33084 | Fluorophore-1 | CCC CTG CAG GTC AAT TCT ACC | Quencher-1 | MUT Probe | ||
33085 | Fluorophore-2 | CTT CCT GGG GCC AGC CT | Quencher-2 | WT Probe | ||
oIMR6592 | GAA AAG CGC CTC CCC TAC | Mutant Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33082 | 0.40 uM |
33083 | 0.40 uM |
oIMR6592 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |