Stock No: 008275
Protocol 40116: Probe Assay - Sgca<tm2Kcam> Probe Alt 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:94972095-94972234 140bp CGTGGGTACCAAGTCATCG CACTTGGGCTGTATGCAAAT

Mutant=  102 bp

Wild Type = 140 bp

Sequence

Wt Sequence: CGTGGGTACCAAGTCATCGAGgtgccagcatagaggcatcaaggccctgggggtggccactggggcctaagggtaaccctgccagcgggattGaccgtttagtgtgcttatttgcatataatttgcatacagcccaagtg

 

Mutant Sequence: ctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaattgacctgcaggggccctcgatatcaagcttggctggacgtaaactc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
32181 GAG TTT ACG TCC AGC CAA GC Mutant Reverse A
55000 CAC TTG GGC TGT ATG CAA AT Wild type Forward A
55001 CGT GGG TAC CAA GTC ATC G Wild type Forward A
55004 Fluorophore-1 CTG CCA GCG GGA TTG A Quencher-1 WT Probe
55285 Fluorophore-2 CCC TAC CCG GTA GAA TTG ACC T Quencher-2 MUT Probe
oIMR5316 CTA AAG CGC ATG CTC CAG AC Mutant Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
32181 0.40 uM
55000 0.40 uM
55001 0.40 uM
oIMR5316 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.