Stock No: 008197
Protocol 37864: Probe Assay - Tg(HTT*) Probe
Version 1.0

Notes

This assay cannot distinguish hemi from hom

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Tg=  104 bp

IPC = 74 bp

Sequence

Tg Sequence: AATGGGGGAAATGAACTGCTTTAGTAACATCATCTGTTTTTTCTGTGAGCAGCGTAGCTTGACAGCCATTGGTGAACTCGTGCCCTGTGCTTCCCTGTCCAGAT

 

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52355 AAT GGG GGA AAT GAA CTG CT Transgene Forward A
52356 ATC TGG ACA GGG AAG CAC AG Transgene Reverse A
52357 Fluorophore-1 CAG CGT AGC TTG ACA GCC A Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
52355 0.40 uM
52356 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
004938 FVB-Tg(YAC128)53Hay/J
027379 FVB/N-Tg(HTT*)NXwy/J
008197 FVB/N-Tg(HTT*97Q)IXwy/J
037050 FVB/NJ-Tg(HTT*131Q)BACXwy/120J
035970 NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(YAC128)53Hay/JnolJ
5 strains use this protocol