Stock No: 008194
Protocol 32530: Probe Assay - Gata4<tm1.1Sad> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  143 bp

Wild Type = 143 bp

>chr14:63821675-63821817 143bp TCACATGGTGCTCTGAACTTG CAGATCCCAGTCAATAGCAATGT

Sequence

Wt Sequence: ttttcaagctttaatcaaagcagacaagttcccattagccgtgctcctgacagactgatctataatcggggtacatgtgtatcacatggtgctctgaacttgtacaagttccttcaGGGATCCtctcaagaccccacagaagcagtgtcatcctatcttcctgagaagcaaactgaaagtcaagtgcaatggcctaaaatcacattgctattgactgggatctggaatgttcactccgggatcaatagtctagtcaatataccgttctgttgtcacagtctctatgt

 

Mutant Sequence:AGGAAACCCTATGACGACTGCCCTTGCAATAGGCTGGTTCAATCAGTGTGGGGCCGGAGAGAGAAATTTTGCTCAGTGGTCCATTTTTCAAGCTTTAATCAAAGCAGACAAGTTCCCATTAGCCGTGCTCCTGACAGACTGATCTATAATCGGGGTACATGTGTATCACATGGTGCTCTGAACTTGTACAAGTTCCTTCAGGGATCtcgaggaattccgatcatattcaataacccttaatatAACTTCGTATAATGTATGCTATACGAAGTTATtaggtctgaagaggagtttacgtccagccaagctaGGATCCTCTCAAGACCCCACAGAAGCAGTGTCATCCTATCTTCCTGAGAAGCAAACTGAAAGTCAAGTGCAATGGCCTAAAATCACATTGCTATTGACTGGGATCTGGAATGT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39319 TCA CAT GGT GCT CTG AAC TTG Common A
39320 GCT TGG CTG GAC GTA AAC TC Mutant Reverse A
39321 CAG ATC CCA GTC AAT AGC AAT GT Wild type Reverse A
39322 Fluorophore-1 AGG GAT CTC GAG GAA TTC CGA TC Quencher-1 MUT Probe
39323 Fluorophore-2 TGT CAT CCT ATC TTC CTG AGA AGC A Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39319 0.40 uM
39320 0.40 uM
39321 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.