Protocol 34231: Probe Assay - Tg(Prnp-MAPT*P301S)PS19Vle-Chr3 Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  94 bp

Wild Type = 79 bp

 

>chr3:140017207+140017281 75bp TCACAAACCTAAACTAGTAGCCACA CAATACTTCCATTTTGTCATC This assay is capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 3. 
 
This assay is designed around this insertion site, and can differentiate between hemi and homs.
 
This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

 

 

 

Sequence

Wt Sequence: agtgaactattagtgtggtttgttcctgacatgcattctttctatcacaaacctaaactagtagccacagtgttggggtttTTgagatttttctgagTgatgacaaaatggaagtattgAagaaaaaagtctgatttttactactgagtctcaaaattctaaaattagggtcaaaatcctaattttaaatgagaagaaatggtttgtgttccaagaactctatccaaaatgattaagtgacctagaaaag

 

Mutant Sequence:TGAACCATCACACTGGCTAGTGAACTATTAGTGTGGTTTGTTCCTGACATGCATTCTTTCTATCACAAACCTAAACTAGTAGCCACAGTGTTGGGGTTTTcgacggatccaaaggcagcaaaaaggcagAgagggtgatactgggcctggcttaagcatttgaaacttcaaagctcacccccaattacacacttcttccaacaagtccacacctcctaattagtgccactctctgtgggcctacggagagtattttcattctaactaccaca

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
43113 TCA CAA ACC TAA ACT AGT AGC CAC A Common A
43114 CTT AAG CCA GGC CCA GTA TC Mutant Reverse A
43115 TCT TCA ATA CTT CCA TTT TGT CAT C Wild type Reverse A
43116 Fluorophore-1 CAA AGG CAG CAA AAA GGC AG Quencher-1 MUT Probe
43117 Fluorophore-2 TGG GGT TTT TGA GAT TTT TCT GAG Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
43113 0.40 uM
43114 0.40 uM
43115 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.