Protocol 34005: Standard PCR Assay - Tg(Prnp-MAPT*P301S)PS19Vle-Chr3
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 331 bp
Heterozygote = 279 bp and 331 bp
Wild type = 279 bp

>chr3:140017101+140017379 279bp TTGAAGTTGGGTTATCAATTTGG TTCTTGGAACACAAACCATTTC

This assay may be capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 3.
 
This assay is designed around this insertion site, but it has not been tested on hom animals.
 
This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
42638 TTG AAG TTG GGT TAT CAA TTT GG Common A mChr3
42639 TTC TTG GAA CAC AAA CCA TTT C Wild type Reverse A mChr3
42640 AAA TTC CTC AGC AAC TGT GGT Mutant Reverse A Prnp

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
42638 0.50 uM
42639 0.50 uM
42640 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
008169 B6;C3-Tg(Prnp-MAPT*P301S)PS19Vle/J
024841 B6N.Cg-Tg(Prnp-MAPT*P301S)PS19Vle/J
2 strains use this protocol