For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 008154
Protocol 35681: Probe Assay - Ppara<tm1Gonz> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 80bp
Wild Type = 88bp
>chr15:85801047+85801134 88bp AGTTGCAGGAGGGGATTGT TGAAGGAGCTTTGGGAAGAG
Sequence
Wt Sequence: cctccactgactggggcctctccgatggccgcactcagacgtctttttcttcttttgagcgtagATCGGCCTGGCCTTCTAAACATAGGCTACATTGAGAAGTTGCAGGAGGGGATTGTGCACGTGCTTAAGCTCCACctgcaGAGCAACCATCCAGATGACACCTTCCTCTTCCCAAAGCTCCTTCAAAAAATGGTGGACCTTCGGCAGCTGGTCACGGAgcatgCGCAGCTCGTACAGGTCATCAAGAAGACCGAGTCCGACGCAGCGCTGCACCCACTGTTGCAA
Mutant Sequence:ACACTTGACTCCTCCACTGACTGGGGCCTCTCCGATGGCCGCACTCAGACGTCTTTTTCTTCTTTTGAGCGTAGATCGGCCTGGCCTTCTAAACATAGGCTACATTGAGAAGTTGCAGGAGGGGATTGTGCACGTGCTTAAGCTCCACCTGCAGgcatgcaagctcggatccgaacaaacgacccaacacccgtgcgttttattctgtctttttattgccGATCCCCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46710 | AGT TGC AGG AGG GGA TTG T | Common | A | |||
| 46714 | TGA AGG AGC TTT GGG AAG AG | Wild type Reverse | A | |||
| 46715 | Fluorophore-1 | CTG CAG GCA TGC AAG CTC G | Quencher-1 | MUT Probe | ||
| 46716 | Fluorophore-2 | CTC CAC CTG CAG AGC AAC CAT C | Quencher-2 | WT Probe | ||
| oIMR5241 | GTG TTG GGT CGT TTG TTC G | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46710 | 0.40 uM |
| 46714 | 0.40 uM |
| oIMR5241 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.