For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 008101
Protocol 30710: Probe Assay - Ptgs2<tm1.1Fun> Probe Alternate1
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 86 bp
Wild Type = 159 bp
>chr1:151952242+151952400 159bp TCTAAAAGGATCAGGGATTAAGTG CCATTCCCACTCCTCTTTCTC
Sequence
Wt Sequence:tctaaattttctaaaaggatcagggattaagtgggaaaagagaacgtgagagggcatttagtgaagggataaactatcttcctcttcctcctcctcctcctccttttcttcttcttctTCTAGaaatagaaaaggaccgagtttactgagaaagaggagtgggaatggggtcagctagtgagcgggggaaagcctatgct
Mutant Sequence: gataaactatcttcctcttcctcctcctcctcctccttttcttcttcttcttctagTCGAGGGACCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTAAGGGTTATTGAATATGATCGGAATTCCTCGACTCTAGAGGATCCACCGGAtctagaaatagaaaaggaccgagtttactgagaaagaggagtgggaatggggtcagctagtgagcgggggaaagcctatgctcaacagccaggacaattgtcacccgttc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35250 | TCT AAA AGG ATC AGG GAT TAA GTG | Wild type Forward | A | |||
| 35251 | CCA TTC CCA CTC CTC TTT CTC | Common | A | |||
| 35252 | TGA TCG GAA TTC CTC GAC T | Mutant Forward | A | |||
| 35253 | Fluorophore-1 | AGA GGA TCC ACC GGA TCT AGA AAT AG | Quencher-1 | MUT Probe | ||
| 35254 | Fluorophore-2 | CGT GAG AGG GCA TTT AGT GAA GG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35250 | 0.40 uM |
| 35251 | 0.40 uM |
| 35252 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.