Protocol 32885: Probe Assay - Ndor1<Tg(UBC-cre/ERT2)1Ejb>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 72 bp

Wt= 93 bp

>chr2:25105303-25105395 93bp TCACCAACCAGAGGGTCACT GGGTTCCTTACCTGATATTGGA
 

This assay may be capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 2.
This assay is designed around this insertion site, but it has not been tested on hom animals.
 

This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

 

Sequence

Wt Sequence:

CTTGCCCTCCAAGTTCATCTTTCAGTTTCTTCAGGAGGTCCCCAGCATAGGGGCTGAGGAGCTCAACATAGCCAGCTCAGCCCCTCAGACACCCCCATCAGAGTTACAGCCCTTCCTGGCACCTGTGATCACCAACCAGAGGGTCACTGGCCCCCAACACTTTCAGGATGTTCGGCTGATTgaATTTGACATTACAGACTCCAATATCAGgtaaggaacccaagccctcaggcagtcaggcagggtgcccatatattcctaggaagctgatgtggtcagggaaaaggtaggcagtagttagggcttcacaagggtatgccagagccaaaggccaggcagttccgagagcttga

Mutant Sequence:
 
TAGTTCTGCCAATCAGGGAAGTAGCCTTGTGTGTGGTAGATCCACAGATCAAGGATATCTTGTCTTCGTTGGGAGTGAATTAGCCCTTCCAATTTGACATTACAGACTCCAATATCAGGTAAGGAACCCAAGCCCTCAGGCAGTCAGGCAGGGTGCCCATATATTCCTAGGAAGCTGATGTGGTCAGGGAAAAGGTAGGCAGTAGTTAGGGCTTCAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
40196 TCA CCA ACC AGA GGG TCA CT Wild type Forward A Ndor1
40197 GGG TTC CTT ACC TGA TAT TGG A Common A Ndor1
40198 TCT TGT CTT CGT TGG GAG TG Mutant Forward A vector
40199 Fluorophore-1 TTC GGC TGA TTG AAT TTG ACA TTA Quencher-1 WT Probe
40200 Fluorophore-2 ATT AGC CCT TCC AAT TTG ACA TTA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
40196 0.40 uM
40197 0.40 uM
40198 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
007001 B6.Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/1J
008085 B6.Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/2J
2 strains use this protocol