For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 007966
Protocol 37947: Probe Assay - Tg(CAG-cre)- Probe
Version 1.0
Notes
This assay cannot distinguish hemi from hom
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Tg= 124 bp
IPC = 74 bp
Sequence
Tg Sequence:
TGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTCGGGCCCCCCCTCGAGGGGCAGAGCCGATCCTGTACACTTTACTTAAAACCATTATCTGAGTGTGAAATGTTCAATTTACTGACCGTACACCAAAATTTGCCTAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34918 | TGT GCT GTC TCA TCA TTT TGG | Transgene Forward | A | |||
| 52581 | TTG GTG TAC GGT CAG TAA ATT G | Transgene Reverse | A | |||
| 52582 | Fluorophore-1 | AGG GGC AGA GCC GAT CCT | Quencher-1 | Tg Probe | ||
| oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
| oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
| TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34918 | 0.40 uM |
| 52581 | 0.40 uM |
| oIMR1544 | 0.40 uM |
| oIMR3580 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 007966 | B6.Cg-Smn1tm3(SMN2/Smn1)Mrph/J |
| 004682 | B6.Cg-Tg(CAG-cre/Esr1*)5Amc/J |
| 034156 | B6N(Cg)-Pex16tm1d(EUCOMM)Hmgu/LutzyJ |
| 019102 | B6N.Cg-Tg(CAG-cre/Esr1*)5Amc/CjDswJ |
| 017595 | FVB.Cg-Tg(CAG-cre/Esr1*)5Amc/J |
| 034859 | NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CAG-cre/Esr1*)5Amc/J |
| 034795 | NOD.Cg-Tg(CAG-cre/Esr1*)5Amc/J |
| 008783 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J |
| 008813 | STOCK Trpa1tm2Kykw Tg(CAG-cre/Esr1*)5Amc/J |
| 004453 | STOCK Tg(CAG-cre/Esr1*)5Amc/J |
| 10 strains use this protocol | |