Protocol 29940: QPCR Assay - Humanized Renilla GFP qPCR
Version 3.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

AGTACCCCGAGGACATCAGCGACTTCTTCATCCAGAGCTTCCCCGCCGGCTTCGTGTACGAGC
GCACCCTGCGCTACGAGGACGGCGGCCTGGTGGAGATCCGCAGCGACATCAACCTGATCGAG
GGGATGTTCGTGTACCGCGTGGAGTACAAGGGCCGCAACTTCCCCAACGACGGCCCCGTGAT
GAAGAAGACCATCACCGGCCTGCAGCCCAGCTTCGAGGTGGTGTACATGAACGACGGCGTGC
TGGTGGGCCAGGTGATCCTGGTGTACCGCCTGAACAGCGGCAAGTTCTACAGCTGCCACATG
CGCA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
15000 AGC GAC ATC AAC CTG ATC G Transgene Forward A
15001 TTC ATG TAC ACC ACC TCG AAG Transgene Reverse A
15002 Fluorophore-1 AGT TGC GGC CCT TGT ACT CCA Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
ddH2O
Kapa Probe Fast QPCR 1.00 X
15000 0.40 uM
15001 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Tg Probe 0.15 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.