Protocol 41125: Probe Assay - Gt(ROSA)26Sor<tm6(CAG-ZsGreen1)Hze> Probe Alternate1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  160 bp

Wild Type = 193 bp

chr6:113075919-113076111 193bp CTGGCTTCTGAGGACCG AATCTGTGGGAAGTCTTGTCC

Sequence

Wt Sequence: gtgttgcaatacctttctgggagttctctgctgcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgcaactccagtctTTCTagaagatgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcaggggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgggaagttttttaataggggcaaataaggaaaatgggaggataggtagtcatctggggttttatgcagcaaaactacaggttattattgcttgtgatccgcctcggagtattttccatcgaggtagattaaagacatgctc

 

Mutant Sequence: TCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTGCGACTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCCCCATCAAGCTGATCCGGAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCCCTCGACCTGCAGCCCAAGCTAGATCGAATTCGGCCGGCCGATATCGGCGCGCCGCCACCATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21306 CTG GCT TCT GAG GAC CG Wild type Forward A
21309 AAT CTG TGG GAA GTC TTG TCC Wild type Reverse A
21310 Fluorophore-1 TAA CCT GGT GTG TGG GCG TTG T Quencher-1 WT Probe
53219 GCT GAT CCG GAA CCC TTA AT Mutant Forward A STOP
57562 TGG TCA TCT CCT TGG TCA GG Mutant Reverse A ZsGreen
57563 Fluorophore-2 CCA TGG CCC AGT CCA AGC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
21306 0.40 uM
21309 0.40 uM
53219 0.40 uM
57562 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.