For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr2:101643014-101643119 106bp CGACTCTGCTTTGGTGTCTG CACCACTGTGAAGGGACCA
Mutant= 110 bp
Wild Type = 106 bp
Wt Sequence: CGACTCTGCTTTGGTGTCTGCTTTGATGGACATGGAAGAAGACATCTTGGAAGGCATGAGATCCCAAgatcttgatgactacctgaatggtcccttcacagtggtg
Mutant Sequence: ctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaattcctgcagcccggggGATCTTGATGACTACCTGAATGGTCCCTTCACAGTGGTG
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35458 | Fluorophore-1 | CAT CTT GGA AGG CAT GAG ATC | Quencher-1 | WT Probe | ||
35459 | CGA CTC TGC TTT GGT GTC TG | Wild type Forward | A | |||
35460 | CAC CAC TGT GAA GGG ACC A | Common | A | |||
35461 | Fluorophore-2 | TGG GAA AAG CGC CTC C | Quencher-2 | MUT Probe | ||
oIMR5316 | CTA AAG CGC ATG CTC CAG AC | Mutant Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35459 | 0.40 uM |
35460 | 0.40 uM |
oIMR5316 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
Stock Number | Strain Name |
---|---|
032088 | B6.129S-Rag1tm1Mom Cd47tm1Fpl Il2rgtm1Wjl/SzJ |
003174 | B6.129S4-Il2rgtm1Wjl/J |
032562 | FVB.129S7(B6)-Rag1tm1Mom/LcsnJ |
018454 | NOD.Cg-Rag1tm1Mom Fahem1Mvw Il2rgtm1Wjl/MvwJ |
033127 | NOD.Cg-Rag1tm1Mom Flt3tm1Irl Mcph1Tg(HLA-A2.1)1Enge Il2rgtm1Wjl/J |
035855 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(HLA-A/H2-D/B2M)Dvs Tg(HLA-DRA,HLA-DRB1*0401)39-2Kito/J |
030533 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(SLC10A1)15Mvw/MvwJ |
026014 | NOD.Cg-Rag1tm1Mom KitW-41J Il2rgtm1Wjl/EavJ |
017914 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(HLA-DRA,HLA-DRB1*0401)39-2Kito/ScasJ |
007799 | NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/SzJ |
014568 | NOD.Cg-Rag1tm1Mom Ins2Akita Il2rgtm1Wjl/SzJ |
006303 | NOD.FVB-Tg(TcraBDC12-4.1)10Jos/GseJ |
006770 | STOCK Rag1tm1Mom Tg(TIE2GFP)287Sato/J |
13 strains use this protocol |