Protocol 38431: Standard PCR Assay - Tg(UBC-GFP)30Scha-Chr17
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Transgene = 152 bp

WT = 287 bp

>chr17:29435540+29435826 287bp TTTAGTTGCAAGGGTTTCTGG CCAGCAAGATGTAGGAGGATG

This assay is capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 17.

This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
53806 TTT AGT TGC AAG GGT TTC TGG Common A mChr17
53807 GGG CGG AAG GAT CAG GAC Mutant Reverse A Human UBC
53886 CCA GCA AGA TGT AGG AGG ATG Wild type Reverse A mChr17

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
53806 0.50 uM
53807 0.50 uM
53886 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
004353 C57BL/6-Tg(UBC-GFP)30Scha/J
007076 CByJ.B6-Tg(UBC-GFP)30Scha H2b/J
034677 CByJ.B6-Tg(UBC-GFP)30Scha/J
3 strains use this protocol