Protocol 32708: Probe Assay - Tg(Camk2a-tTA)1Mmay-Chr12-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 86 bp

Wt= 86 bp

>chr12:117847681+117847766 86bp AGCCATAACTGCCTCTTGGA CCCCTAAGCTGCTTTACTCG

Sequence

Wt Sequence:

aatcaaagccataactgcctcttggaaaaatatatttatgtattcattccctagtgctggggtaaaacACcccgagtaaagcagcttaggggaggaagaagttatttccactcacagttcaaggttcatcct  

Mutant Sequence:
TCGCCATCAAGGGCAGCGAGGGCTTCTCCAGATAAAATAGCTTCTGCCGAGAGTCCCGTAAGGGTAGACACTTCAGCTAATCCCTCGAGCGCGGCCGCCACGGTCGAGGCCgcCCCGAGTAAAGCAGCTTAGGGGAGGAAGAAGTTATTTCCACTCACAGTTCAAGGTTCATCCTATCATGGTGGAGGAGTCAGGGTGGAAGGAGCTTGAAGCAGCTGGTCACACTGAAACCAGGAAGAGA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39778 AGC CAT AAC TGC CTC TTG GA Wild type Forward A
39779 CCC CTA AGC TGC TTT ACT CG Common A
39780 Fluorophore-1 CAT TCC CTA GTG CTG GGG TAA Quencher-1 WT Probe
39781 AGA GTC CCG TAA GGG TAG ACA Mutant Forward A vector
39782 Fluorophore-2 TCA GCT AAT CCC TCG AGC G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39778 0.40 uM
39779 0.40 uM
39781 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.