For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 007001
Protocol 32885: Probe Assay - Ndor1<Tg(UBC-cre/ERT2)1Ejb>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut= 72 bp
Wt= 93 bp
>chr2:25105303-25105395 93bp TCACCAACCAGAGGGTCACT GGGTTCCTTACCTGATATTGGA
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 2.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
Sequence
Wt Sequence:
CTTGCCCTCCAAGTTCATCTTTCAGTTTCTTCAGGAGGTCCCCAGCATAGGGGCTGAGGAGCTCAACATAGCCAGCTCAGCCCCTCAGACACCCCCATCAGAGTTACAGCCCTTCCTGGCACCTGTGATCACCAACCAGAGGGTCACTGGCCCCCAACACTTTCAGGATGTTCGGCTGATTgaATTTGACATTACAGACTCCAATATCAGgtaaggaacccaagccctcaggcagtcaggcagggtgcccatatattcctaggaagctgatgtggtcagggaaaaggtaggcagtagttagggcttcacaagggtatgccagagccaaaggccaggcagttccgagagcttga
Mutant Sequence:
TAGTTCTGCCAATCAGGGAAGTAGCCTTGTGTGTGGTAGATCCACAGATCAAGGATATCTTGTCTTCGTTGGGAGTGAATTAGCCCTTCCAATTTGACATTACAGACTCCAATATCAGGTAAGGAACCCAAGCCCTCAGGCAGTCAGGCAGGGTGCCCATATATTCCTAGGAAGCTGATGTGGTCAGGGAAAAGGTAGGCAGTAGTTAGGGCTTCAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40196 | TCA CCA ACC AGA GGG TCA CT | Wild type Forward | A | Ndor1 | ||
| 40197 | GGG TTC CTT ACC TGA TAT TGG A | Common | A | Ndor1 | ||
| 40198 | TCT TGT CTT CGT TGG GAG TG | Mutant Forward | A | vector | ||
| 40199 | Fluorophore-1 | TTC GGC TGA TTG AAT TTG ACA TTA | Quencher-1 | WT Probe | ||
| 40200 | Fluorophore-2 | ATT AGC CCT TCC AAT TTG ACA TTA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40196 | 0.40 uM |
| 40197 | 0.40 uM |
| 40198 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.