For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 006942
Protocol 30875: Probe Assay - Cd33<tm1Ajv> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:43533590-43533726 137bp TGATGTGCTTCTGCCACATAC AGCTGGAATCTTGGCTCTTG
Mutant= 137 bp
Wild Type = 137 bp
Sequence
Wt Sequence: tgatgtgcttctgccacatactcattcatttattcaTtccttcattcatttattcattccctcatacttcaccctacaggaattCACCCCCCTCATTTCTTTGTAGGGTCCCTGGATCAAGAGCCAAGATTCCAGCT
Mutant Sequence: TGATGTGCTTCTGCCACATACTCATTCATTTATTCACTCCTTCATTCATTTATTCATTCCCTCATAgTTCACCCTACAGGAATTCtaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttag
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35702 | TGA TGT GCT TCT GCC ACA TAC | Common | A | |||
| 35703 | AGC TGG AAT CTT GGC TCT TG | Wild type Reverse | A | |||
| 35704 | Fluorophore-1 | AGG CGC TTT TCC CAA GG | Quencher-1 | MUT Probe | ||
| 35705 | Fluorophore-2 | CCC TCA TTT CTT TGT AGG GTC C | Quencher-2 | WT Probe | ||
| oIMR5316 | CTA AAG CGC ATG CTC CAG AC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35702 | 0.40 uM |
| 35703 | 0.40 uM |
| oIMR5316 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.