Stock No: 006833
Protocol 36832: Standard PCR Assay - Sgcb<tm1Kcam> Alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 241 bp
Heterozygote = 241 bp and 335 bp
Wild type = 335 bp

>chr5:73636429-73636763 335bp CTCCCTCCAGTGAACAGCAC GATCCGTCTGCCTCTACAGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
18349 TCA GCA GCC TCT GTT CCA C Mutant Forward A Mut F
49834 CTC CCT CCA GTG AAC AGC AC Wild type Forward A Wt F
49835 GAT CCG TCT GCC TCT ACA GC Wild type Reverse A Wt R
49836 CCA TGA CAG TAT TTT CTT TAG TGC Mutant Reverse A Mut R

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
18349 0.50 uM
49834 0.50 uM
49835 0.50 uM
49836 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
006831 129-Sgcbtm1Kcam/J
006832 B6.129-Sgcbtm1Kcam/1J
006833 B6.129-Sgcbtm1Kcam/2J
3 strains use this protocol