Stock No: 006679
Protocol 31749: Probe Assay - Generic DsRed Probe
Version 1.0


This assay cannot distinguish hemi from hom


The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Tg=  81 bp

IPC = 74 bp


Tg Sequence: aggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtgatgcagaagaagacca



JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37529 AGG ACG GCT GCT TCA TCT AC Transgene Forward A
37530 TGG TCT TCT TCT GCA TCA CG Transgene Reverse A
37531 Fluorophore-1 AGT TCA TCG GCG TGA ACT TC Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
37529 0.40 uM
37530 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM


Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
006055 B6.Cg-Tg(CAG-Bgeo,-DsRed*MST)1Nagy/J
006051 B6.Cg-Tg(CAG-DsRed*MST)1Nagy/J
008705 B6.Cg-Tg(CAG-DsRed,-EGFP)5Gae/J
006872 B6.Cg-Tg(Ins1-DsRed*T4)32Hara/J
018410 B6.Cg-Tg(Pnkd*A7V*A9V,-DsRed)671Ljp/J
013082 B6.FVB-Tg(Per2-DsRed*T3)12Obr/Mmjax
006679 B6;129P2-Olfr151tm27Mom/MomJ
029332 B6N.Cg-Tg(P2rx4-tdTomato)1Khakh/J
009655 C57BL/6J-Tg(Dcx-DsRed)14Qlu/J
005328 NOD/ShiLt-Tg(Cd4-DsRed)4Lt/J
005438 STOCK Tg(CAG-Bgeo,-DsRed*MST)1Nagy/J
005441 STOCK Tg(CAG-DsRed*MST)1Nagy/J
008241 STOCK Tg(Cspg4-DsRed.T1)1Akik/J
13 strains use this protocol