Protocol 40841: End Point Analysis Assay - Gusb<mps> EP Alternate2
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant =-/-
Heterozygote = C/-
Wild type = C/C

chr5:129993523-129993623 101bp GTAAATTCACTCGACCGCTCTT CACCTCCAAATGCCCATAGT

The Fwd primer (primer 56143) anneals over the nucleotide sequence containing mouse genomic variations rs48872564. 

The WT & Mut probes anneal over the nucleotide sequence containing mouse genomic variation rs48332902

Sequence

cgaccgctcttgtcttagGCCC(C/-)GTACGTGGATGTTATCTGTGTAAACAGCTACTTTTCTTGGTATCATGAC
TATGGGCATTTGGAGGTGATTCAGCCACAGCTGAATAGCCAGTTTGAGAACTGGTATA
AGACGCATCAGAAGCCGATTATCCAGAGCGAGTATGGAGCAGACGCAATCCCAGGGATCCACGAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
56143 GTA AAT TCA CTC GAC CGC TCT T Forward A
56144 CAC CTC CAA ATG CCC ATA GT Reverse A
56145 Fluorophore-1 TCT TAG GCC CCG TAC GTG GAT Quencher-1 WT Probe
56929 Fluorophore-2 CTT AGG CCC GTA CGT GGA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
56143 0.40 uM
56144 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
006564 B6(C)-KitW-41J Gusbmps/BrkJ
006559 B6.C-H2-Kbm1/ByBir-Gusbmps/BrkJ
000256 B6.C-H2-Kbm1/ByBir-Gusbmps/J
006562 B6.CBy(Cg)-Gusbmps Gpi1a-m1J/BrkJ
002086 B6.Cg-Gusbmps Tg(Gussx)1Wat/J
006407 B6.Cg-Gusbmps/BrkJ
005053 NOD.Cg-Prkdcscid Gusbmps/SndsJ
001880 STOCK Gusbmps Tg(GUSB)4Sly/BirJ
8 strains use this protocol