Protocol 35225: Probe Assay - Gt(ROSA)26Sor<tm1(HIF1A/luc)Kael> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:113025913-113026105 193bp CTGGCTTCTGAGGACCG AATCTGTGGGAAGTCTTGTCC

 

Mutant=  140 bp

Wild Type =193 bp

Sequence

Wt Sequence:

AATCTGTGGGAAGTCTTGTCCCTCCAATTTTACACCTGTTCAATTCCCCT
GCAGGACAACGCCCACACACCAGGTTAGCCTTTAAGCCTGCCCAGAAGAC
TCCCGCCCATCTTCTAGAAAGACTGGAGTTGCAGATCACGAGGGAAGAGG
GGGAAGGGATTCTCCCAGGCCCAGGGCGGTCCTCAGAAGCCAG

 

Mutant Sequence:

TTTGCTTCTGTGTCTTCAGCAAAAAGTTTTTCTACCAATTCCAACTTGAATTCcatggtggcgaattcggatccaagcttcgaggtcgacggtatcgataagctagcttgggctgcaggtcgagggacctaataacttcg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21306 CTG GCT TCT GAG GAC CG Wild type Forward A
21309 AAT CTG TGG GAA GTC TTG TCC Wild type Reverse A
21310 Fluorophore-1 TAA CCT GGT GTG TGG GCG TTG T Quencher-1 WT Probe
45556 TTT GCT TCT GTG TCT TCA GCA Mutant Forward A
45557 Fluorophore-2 TGA ATT CCA TGG TGG CGA Quencher-2 MUT Probe
oIMR7882 CGA AGT TAT TAG GTC CCT CGA C Mutant Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
21306 0.40 uM
21309 0.40 uM
45556 0.40 uM
oIMR7882 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.