Protocol 35526: Probe Assay - Mbl1<tm1Kata> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr14:41158744+41158852 109bp CAGCAACTGGAAAAAGGATGA CTTGAAGGAAGCTTGACAGGA

Mutant=  108 bp

Wild Type = 109 bp

Sequence

Wt Sequence: CAGCAACTGGAAAAAGGATGAGCCAAATAACCATGGctCTGGGGAAGACTGTGTCATTATATTAGATAATGGTTTGTGGAATGACATTTCCTgtcaagcttccttCAAG

 

Mutant Sequence: CAGCAACTGGAAAAAGGATGAGCCAAATAACCATgctagagtcagcttctgatggaattagaacttggcaaaacaatactgagaatgaagtgtatgtggaacagaggc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
46296 CAG CAA CTG GAA AAA GGA TGA Common A
46297 CTT GAA GGA AGC TTG ACA GGA Wild type Reverse A
46298 GCC TCT GTT CCA CAT ACA CTT C Mutant Reverse A
46299 Fluorophore-1 CAT GCT AGA GTC AGC TTC TGA TGG Quencher-1 MUT Probe
46300 Fluorophore-2 CTC TGG GGA AGA CTG TGT CA Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
46296 0.40 uM
46297 0.40 uM
46298 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.