Stock No: 006046
Protocol 21941: End Point Analysis Assay - Dscam<3J>
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

WT = G/G

Mut = C/C

 

Sequence

ccacatccgatttcctgagtgtcttcttctctcctgtttagGCTCCCAAGAAACACTT

ACAAAACGGGATCATTC(g/c)CGGCTACCAAATAGGCTACCGG

GAGTACAGCACGGGGGGTAACTTCCAGTTCAACATCA

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
17073 CCA CAT CCG ATT TCC TGA GT Forward A
17074 TGA TGT TGA ACT GGA AGT TAC CC Reverse A
17075 Fluorophore-1 GGA TCA TTC GCG GCT ACC A Quencher-1 WT Probe
17077 Fluorophore-2 GGA TCA TTC CCG GCT ACC A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
17073 0.40 uM
17074 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.