For in-depth product & services help, ask our
Technical Information Scientists
Mutant = 260 bp
Heterozygote = 160 bp and 260 bp
Wild type = 160 bp
>chr6:41555804+41555963 160bp CAAACAATCCTCTCATTTGGAAC TTCCTGTTGGAACTCTGTGC
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 6.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
48479 | CAA ACA ATC CTC TCA TTT GGA AC | Common | A | mChr6 | ||
48480 | TTC CTG TTG GAA CTC TGT GC | Wild type Reverse | A | mChr6 | ||
48481 | GGC TTC TCC TGG ATC TGA AG | Mutant Reverse | A | mChr14 |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTP KAPA | 0.26 mM |
48479 | 0.50 uM |
48480 | 0.50 uM |
48481 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |