Stock No: 005598
Protocol 21924: End Point Analysis Assay - Arsb<m1J>-EP Alternate 2
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant =T/T
Heterozygote = G/T
Wild type = G/G

Sequence

ATCCATTTGGGCTTACAGCATTACCTCATCATGACCTGTCAGCCCAGCTGTGTTCCCCT
AGAC(g/t)AAAAACTCCTGCCCCAGCTTTTAAAGGAAGCAGGCTATGCTACGCACATGG
TCGGGAAATGGCAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
16489 Fluorophore-1 TTC CCC TAG ACT AAA AAC TCC TG Quencher-1 MUT Probe
22629 CCT CAT CAT GAC CTG TCA GC Forward A
22630 GAC CAT GTG CGT AGC ATA GC Reverse A
22631 Fluorophore-2 TCC CCT AGA CGA AAA ACT CCT Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
22629 0.40 uM
22630 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.