Genotyping Protocols Database
Stock No: 005582
Protocol 32483: Probe Assay - Cx3cr1<tm1Litt> Probe Alternate1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  85 bp

Wild Type = 110 bp

>chr9:119961380-119961489 110bp CGTGATCTGGTTTCTCCTTCC CCAAATAACAGGCCTCAGCA

Sequence

Wt Sequence: tcctttaaggctcacgtgatctggtttctccttcccctccagGACCTCACCATGTCCACCTCCTTCCCTGAACTGGATCTAGAGAATTTTGAGTATGACGATTCTGCTGAGGCCTGTTATTTGGGCGACATTGTGGCCTTTGGAACCATCTTCCTGTCCGTCTTCTA

 

Mutant Sequence: GGACCTGCTTACTGCATGCAGCCAGTGAGAACTACAATCCTTTAAGGCTCACGTGATCTGGTTTCTCCTTCCCCTCCAGGACCTCccgcgggcccgggatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
31017 CGT GAT CTG GTT TCT CCT TCC Common A
32856 CTC CTC GCC CTT GCT CAC Mutant Reverse A EGFP
39210 CCA AAT AAC AGG CCT CAG CA Wild type Reverse A
39211 Fluorophore-1 CCA GGA CCT CCC GCG GG Quencher-1 MUT Probe
39212 Fluorophore-2 CCA GGA CCT CAC CAT GTC CAC C Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
31017 0.40 uM
32856 0.40 uM
39210 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
005582 B6.129P2(Cg)-Cx3cr1tm1Litt/J
031478 STOCK Cx3cr1tm1Litt Tg(Prism)1989Htz/J
032127 B6.129(Cg)-Cx3cr1tm1Litt Ccr2tm2.1Ifc/JernJ
3 strains use this protocol