For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 005558
Protocol 37023: End Point Analysis Assay - Jak3<m1J>-EP
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = A/A
Heterozygote = G/A
Wild type = G/G
>chr8:71688044+71688150 107bp AGGAGCTCATGCAGCTGTG CTGCTATCCGGGTCTTCCAC
Sequence
GTTCAGGAGCTCATGCAGCTGTGCTGGGCGCCCAGCCCGCACGACC(g/a)GCCAGCCTTCGGCACCCTGAGCCCCCAGCTGGACGCGCTGTGGCGTGGA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50282 | AGG AGC TCA TGC AGC TGT G | Forward | A | |||
| 50283 | CTG CTA TCC GGG TCT TCC AC | Reverse | A | |||
| 50284 | Fluorophore-1 | ACG ACC GGC CAG CCT | Quencher-1 | WT Probe | ||
| 50285 | Fluorophore-2 | CAC GAC CAG CCA GCC TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50282 | 0.40 uM |
| 50283 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.