Stock No: 005037
Protocol 39946: End Point Analysis Assay - Ticam1<Lps2> End Point Alternate2
Version 5.0

Notes

A standard PCR protocol has been published and can be viewed online at doi: 10.1093/biomethods/bpaa007.  Please note, the assay in this publication has not been validated by The Jackson Laboratory.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = Deletion of highlighted G

Wild Type = Presence of highlighted G

Sequence

CAGCCTCCTCCCCAGCCCCACAGACTCCAGGACCTCAGCCTCTCATTATTCACCATGCCCAGAT
GGTTCAGCTGGGTGTCAACAATCACATGTGGGGCCACACAGGGGCCCAGTCATCTGATGACAA
[g]ACTGAGTGTTCGGAGAACCCCTGTATGGGCCCTCTGACTGATCAGGGCGAACCCCTTCTTG
AGACTCCAGAGTGACCAGGTTGGACCCCACCTAGATGGCTAGAGTGACAAGATTGGACTTC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
15131 Fluorophore-1 ATC TGA TGA CAA GAC TGA GTG TTC G Quencher-1 WT Probe
15132 Fluorophore-2 ATC TGA TGA CAA ACT GAG TGT TCG Quencher-2 MUT Probe
54913 GCT GGG TGT CAA CAA TCA CA Forward A
54914 AGT CAG AGG GCC CAT ACA GG Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
54913 0.40 uM
54914 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.