For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 004586
Protocol 32843: Probe Assay - Tg(Vil1-cre)997Gum-Chr17
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 85 bp
Wild Type = 119 bp
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 17.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
This protocol can be used for conventional PCR. Omit probes and run as a separated assay.
Sequence
Wt Sequence:
ttggttcctggctacctctgctcttatctcttaggtttgactattctaggaactttctatgaatggaactttttcttatgactttggcttatttcatgtacatgctttcaagtttcatccatgttgtagagttgtaatgtgtgtcaagagTGgttttttattctaaattttttaacaatattttatttatatgctaaactgtgttcatctgtctatcatgaacatcctaaatgttccttctc
Mutant Sequence:
TTTCTATGAATGGAACTTTTTCTTATGACTTTGGCTTATTTCATGTACATGCTTTCAAGTTTCATCCATGTTGTAGAGTTGTAATGTGTGTCAAGAGTACCAAGCTTATGGGATAGCTTGGCTTTACCCAAAGACATTACCCCTCTGTGAGGGCCAGAGGCGGGAGGTAAAGGCACGAGGGGCTCCAAAACCAGATCCCCAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40114 | GCT TTC AAG TTT CAT CCA TGT TG | Common | A | mChr17 | ||
| 40115 | TTC ATG ATA GAC AGA TGA ACA CAG T | Wild type Reverse | A | mChr17 | ||
| 40116 | Fluorophore-1 | TGT GTG TCA AGA GTG GTT TTT TAT TCT A | Quencher-1 | WT Probe | ||
| 40117 | GTC TTT GGG TAA AGC CAA GC | Mutant Reverse | A | Mt1 | ||
| 40118 | Fluorophore-2 | TGT CAA GAG TAC CAA GCT TAT GGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40114 | 0.40 uM |
| 40115 | 0.40 uM |
| 40117 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.