For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 004512
Protocol 31878: Standard PCR Assay - 1700016L21Rik<Tg(Itgax-HBEGF/EGFP)57Lan>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 174 bp
Heterozygote = 118 bp and 174 bp
Wild type = 118 bp
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is know to be on mouse Chr 1.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for transgene copy number evalutation. If this is required, it is suggested to type by qPCR.
>chr1:80445225+80445342 118bp ACAACAGAAATCACCCTGGA TGGCAGTGTTAAAATGCAGA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37892 | ACA ACA GAA ATC ACC CTG GA | Common | A | mChr1 | ||
| 37893 | TGG CAG TGT TAA AAT GCA GA | Wild type Reverse | A | mChr1 | ||
| 37894 | CGA GAG GAC CTC AGA CTG CT | Mutant Reverse | A | Itgax |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 37892 | 0.50 uM |
| 37893 | 0.50 uM |
| 37894 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.