Protocol 31878: Standard PCR Assay - 1700016L21Rik<Tg(Itgax-DTR/EGFP)57Lan>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 174 bp
Heterozygote = 118 bp and 174 bp
Wild type = 118 bp

This assay may be capable of distinguishing hemi from hom.  Transgene insertion site is know to be on mouse Chr 1.

This assay is designed around this insertion site, but it has not been tested on hom animals.

This assay is NOT able to be used for transgene copy number evalutation.  If this is required, it is suggested to type by qPCR.

>chr1:80445225+80445342 118bp ACAACAGAAATCACCCTGGA TGGCAGTGTTAAAATGCAGA 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37892 ACA ACA GAA ATC ACC CTG GA Common A mChr1
37893 TGG CAG TGT TAA AAT GCA GA Wild type Reverse A mChr1
37894 CGA GAG GAC CTC AGA CTG CT Mutant Reverse A Itgax

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
37892 0.50 uM
37893 0.50 uM
37894 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
004509 B6.FVB-1700016L21RikTg(Itgax-DTR/EGFP)57Lan/J
004512 C.FVB-1700016L21RikTg(Itgax-DTR/EGFP)57Lan/J
008549 NOD.FVB-1700016L21RikTg(Itgax-DTR/EGFP)57Lan/JdkJ
3 strains use this protocol