For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 004353
Protocol 38431: Standard PCR Assay - Tg(UBC-GFP)30Scha-Chr17
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Transgene = 152 bp
WT = 287 bp
>chr17:29435540+29435826 287bp TTTAGTTGCAAGGGTTTCTGG CCAGCAAGATGTAGGAGGATG
This assay is capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 17.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53806 | TTT AGT TGC AAG GGT TTC TGG | Common | A | mChr17 | ||
| 53807 | GGG CGG AAG GAT CAG GAC | Mutant Reverse | A | Human UBC | ||
| 53886 | CCA GCA AGA TGT AGG AGG ATG | Wild type Reverse | A | mChr17 |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 53806 | 0.50 uM |
| 53807 | 0.50 uM |
| 53886 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.