For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 004192
Protocol 21923: End Point Analysis Assay - Apob<tm2Sgy>EP
Version 3.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 215 bp
Wild type = 215 bp
Sequence
AGGAAAAAATAACTTCTTTCATGGAAAATTATAGAATTACAGATAATGATGTACTAATTGCCATAGATAGTGCCAAAATCAACTTCAATGAAAA(a/g)ct(c/t)TCTCAACTTGAGACATACGCGATACaATTTGATCAGTATATTAAAGATAATTATGATCCACATGACTTAAAAAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 17419 | AAG TAG CTG GTG CCA AGG AA | Forward | A | |||
| 17420 | GAT TCG ATC AAT AAT CTC AGC AA | Reverse | A | |||
| 17421 | Fluorophore-1 | TTC AAT GAA AAA CTC TCT CAA CTT GA | Quencher-1 | WT Probe | ||
| 17422 | Fluorophore-2 | TTC AAT GAA AAG CTT TCT CAA CTT GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 17419 | 0.40 uM |
| 17420 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.