Protocol 21923: End Point Analysis Assay - Apob<tm2Sgy>EP
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 215 bp

Wild type = 215 bp

Sequence

AGGAAAAAATAACTTCTTTCATGGAAAATTATAGAATTACAGATAATGATGTACTAATTGCCATAGATAGTGCCAAAATCAACTTCAATGAAAA(a/g)ct(c/t)TCTCAACTTGAGACATACGCGATACaATTTGATCAGTATATTAAAGATAATTATGATCCACATGACTTAAAAAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
17419 AAG TAG CTG GTG CCA AGG AA Forward A
17420 GAT TCG ATC AAT AAT CTC AGC AA Reverse A
17421 Fluorophore-1 TTC AAT GAA AAA CTC TCT CAA CTT GA Quencher-1 WT Probe
17422 Fluorophore-2 TTC AAT GAA AAG CTT TCT CAA CTT GA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
17419 0.40 uM
17420 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
003000 B6;129S-Ldlrtm1Her Apobtm2Sgy/J
004192 STOCK Mttptm2Sgy Ldlrtm1Her Apobtm2Sgy Tg(Mx1-cre)1Cgn/J
2 strains use this protocol