For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 004128
Protocol 31770: Standard PCR Assay - Tg(Tek-cre)12Flv-Chr13
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 179 bp
Heterozygote = 179 bp and 375 bp
Wild type = 375 bp
>chr13:68839808-68840182 375bp AAAAATCAGCATTTTCAACAAA TTGGATTTTAGTCCCCTATCTGA
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 13.
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 13.
This assay is designed around this insertion site, but it has not be tested on hom animals.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37600 | AAA AAT CAG CAT TTT CAA CAA A | Common | A | mChr13 | ||
| 37603 | TTG GAT TTT AGT CCC CTA TCT GA | Wild type Reverse | A | mChr13 | ||
| 37604 | GTT TAT TTA CCG CCG TGT GTG | Mutant Reverse | A | Tek |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 37600 | 0.50 uM |
| 37603 | 0.50 uM |
| 37604 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.