For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 003961
Protocol 22061: End Point Analysis Assay - Thy1<a>End Point
Version 4.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = G/G
Heterozygote = A/G
Wild type = A/A
Thy1<b> is WT and has A at the indicated location
Thy1<a> is Mut and has G at the indicated location
Sequence
GACCCGAGAGAAGAGGAAGCACGTGCTCTCAGGCACCCTTGGGATACCCGAGCA
CACGTACCGCTCCCGCGTCACCCTCTCCAACCAGCCCTATATCAAGGTCCTTACCC
TAGCCAACTTCACCACCAAGGATGAGGGCGACTACTTTTGTGAGCTTC(a/g)AGTCT
CGGGCGCGAATCCCATGAGCTCCAATAAAAGTATCAGTGTGTATAGAGGTGAGAC
TGGTTCCCAGAAAGATAAAATGTCCAGGTTAGCCAGGCTGGGGTAGCCAATAAAA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 16073 | CTC TCC AAC CAG CCC TAT ATC | Forward | A | |||
| 16074 | GAA CCA GTC TCA CCT CTA TAC AC | Reverse | A | |||
| 16075 | Fluorophore-1 | GTG AGC TTC AAG TCT CGG G | Quencher-1 | WT Probe | ||
| 16076 | Fluorophore-2 | GTG AGC TTC GAG TCT CGG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 16073 | 0.40 uM |
| 16074 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 037115 | B6(Cg)-Kmt2cem1Mgee/J |
| 001317 | B6.Cg-Gpi1a Thy1a Igha/J |
| 034140 | B6.Cg-Il17a/Il17ftm1.1Impr Thy1a/J |
| 038742 | B6.Cg-Thy1a Rbm5tm1.1Ozg/PkocJ |
| 035728 | B6.Cg-Thy1a Tg(CD2-Tcra,-Tcrb)27Glkm/J |
| 005023 | B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J |
| 000406 | B6.PL-Thy1a/CyJ |
| 025854 | B6;FVB-Ptprca Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J |
| 017351 | BKa.Cg-Ptprcb Bmi1tm1Ilw Thy1a/J |
| 007686 | BKa.Cg-Sox17tm2Sjm Ptprcb Thy1a/J |
| 036333 | C.Cg-Rag2tm1Fwa Thy1a/AkhoAbhmJ |
| 036332 | C.Cg-Thy1a Tg(DO11.10)10Dlo/AkhoAbhmJ |
| 005307 | CBy.Cg-Thy1a Tg(TcraCl4,TcrbCl4)1Shrm/ShrmJ |
| 005443 | CBy.PL(B6)-Thy1a/ScrJ |
| 024476 | NOD.Cg-Stat4tm1Gru Thy1a Ifngr1tm1Agt Tg(TcraBDC2.5,TcrbBDC2.5)1Doi/LmbrJ |
| 004483 | NOD.NON-Thy1a/1LtJ |
| 005651 | SJL.AK-Thy1a/TseJ |
| 003961 | SJL.Cg Thy1a-Noxo1hslt/J |
| 025855 | STOCK Ptprca Lag3tm1Doi Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J |
| 19 strains use this protocol | |