For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 003923
Protocol 21932: End Point Analysis Assay - Cpe<fat>End Point
Version 3.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = C/C
Heterozygote = T/C
Wild type = T/T
Sequence
gagcagtctctcttgctttctttgtcttttctgtgacatcaccagtggcgattgtcagcttct
gagtcttgtgatctttcctctttgaaacagCTTGCCCCCGAGACCAAGGCTGTCATTCACTGG
ATCATGGACATTCCATTTGTGCTT(t/c)CTGCCAATCTGCACGGAGGAGACCTTGTGGCTAAT
TACCCATATGATGAGACACGGAGCGgtaggtagtccccacttcctgccccctttaagtggctt
aagtcaaaaatgacagcacgatttctgtatgag
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 14942 | ACC AAG GCT GTC ATT CAC TG | Forward | A | |||
| 14943 | GGT AAT TAG CCA CAA GGT CTC C | Reverse | A | |||
| 14944 | Fluorophore-1 | ATT TGT GCT TTC TGC CAA TCT | Quencher-1 | WT Probe | ||
| 14945 | Fluorophore-2 | ATT TGT GCT TCC TGC CAA TCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 14942 | 0.40 uM |
| 14943 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.